Top » Catalog » R1b » A593

$18.00

A593
[A593]

A593
hg38 Position: ChrY:18997426..18997426
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A593_F AAGGAATTGTTTCTCAACCTGG
Reverse Primer: A593_R TGCAGAAGAATGCATCCAAAC
Reviews

Customers who bought this product also purchased
A588
A588
A594
A594
A585
A585
A592
A592
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A662
1 x A893
$36.00
Haplogroup Info
Other products
Currencies