Top » Catalog » R1b » A596

$18.00

A596
[A596]

A596
hg38 Position: ChrY:20570453..20570453
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A596_F CTTGCTGAGGAGAGCAGGAG
Reverse Primer: A596_R TGAGGTAAGACTGACCACTGGTC
Reviews

Customers who bought this product also purchased
A588
A588
A593
A593
A585
A585
A592
A592
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A308
$18.00
Haplogroup Info
Other products
Currencies