Top » Catalog » R1b » A597

$18.00

A597
[A597]

A597
hg38 Position: ChrY:21130226..21130226
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A597_F ACAAGATTCATCCACAATGTGG
Reverse Primer: A597_R CAACTGCCACAACCCAATAAC
Reviews

Customers who bought this product also purchased
A585
A585
A592
A592
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
A591
A591
A599
A599
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
1 x A776
1 x A1077
1 x A291
1 x A391
$108.00
Haplogroup Info
Other products
Currencies