Top » Catalog » R1b » A597

$18.00

A597
[A597]

A597
hg38 Position: ChrY:21130226..21130226
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A597_F ACAAGATTCATCCACAATGTGG
Reverse Primer: A597_R CAACTGCCACAACCCAATAAC
Reviews

Customers who bought this product also purchased
A596
A596
A589
A589
A594
A594
A588
A588
A593
A593
A585
A585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies