Top » Catalog » R1b » A599

$18.00

A599
[A599]

A599
hg38 Position: ChrY:21853922..21853922
Ancestral: C
Derived: G
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A599_F GTTATACGGCATTTGCCGAG
Reverse Primer: A599_R GTGATGAATTAAATCTGCCCG
Reviews

Customers who bought this product also purchased
A588
A588
A593
A593
A585
A585
A592
A592
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A923
1 x A132
1 x A96
1 x A2122
1 x A17
1 x A1746
$108.00
Haplogroup Info
Other products
Currencies