Top » Catalog » R1b » A671

$18.00

A671
[A671]

A671
hg38 Position: ChrY:8887580..8887580
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A671v2_F AGGCAGAAAGCTGTTAGAAGAAAG
Reverse Primer: A671v2_R AGTTGTCTTACTCCCTTATCTGACTCTAC
Reviews

Customers who bought this product also purchased
DF98
DF98
S1791
S1791
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
A680
A680
Z301
Z301
L1
L1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1036
$18.00
Haplogroup Info
Other products
Currencies