Top » Catalog » R1b » A671

$18.00

A671
[A671]

A671
hg38 Position: ChrY:8887580..8887580
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A671v2_F AGGCAGAAAGCTGTTAGAAGAAAG
Reverse Primer: A671v2_R AGTTGTCTTACTCCCTTATCTGACTCTAC
Reviews

Customers who bought this product also purchased
U106
U106
DF96
DF96
A415
A415
L48
L48
DF98
DF98
S1791
S1791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2194
1 x A887
1 x A987
1 x A2201
1 x A458
1 x A189
1 x A1729
1 x A560
1 x A2070
1 x A669
1 x A411
$198.00
Haplogroup Info
Other products
Currencies