Top » Catalog » R1b » A674

$18.00

A674
[A674]

A674
hg38 Position: ChrY:11953008..11953008
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A674_F CTACATGGGGGACTGAGGTG
Reverse Primer: A674_R GTCGCAATCCTCTTCCTGAC
Reviews

Customers who bought this product also purchased
A677
A677
A676
A676
A675
A675
A673
A673
A671
A671
A679
A679
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies