Top » Catalog » R1b » A674

$18.00

A674
[A674]

A674
hg38 Position: ChrY:11953008..11953008
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A674_F CTACATGGGGGACTGAGGTG
Reverse Primer: A674_R GTCGCAATCCTCTTCCTGAC
Reviews

Customers who bought this product also purchased
A679
A679
Wish a SNP
Wish a SNP
A677
A677
A676
A676
A675
A675
A673
A673
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
1 x A776
1 x A1077
1 x A291
1 x A391
1 x A91
1 x A1239
1 x A1500
1 x A2266
1 x A137
1 x A611
1 x A589
1 x A956
1 x A1335
1 x A88
1 x A1281
1 x A311
$324.00
Haplogroup Info
Other products
Currencies