Top » Catalog » R1b » A675

$18.00

A675
[A675]

A675
hg38 Position: ChrY:15007812..15007812
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A675_F CCATGATTAATTTTTGTGTCCAC
Reverse Primer: A675_R CGATGAAATCATACTAAACATCACC
Reviews

Customers who bought this product also purchased
A676
A676
A674
A674
A673
A673
A671
A671
A679
A679
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
1 x A240
1 x A896
1 x A848
1 x A344
1 x A16
1 x A1067
1 x A1120
1 x A938
1 x A1341
1 x A568
$252.00
Haplogroup Info
Other products
Currencies