Top » Catalog » R1b » A677

$18.00

A677
[A677]

A677
hg38 Position: ChrY:20025630..20025630
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A677_F GCCACAAAAATGAGGAAAAGG
Reverse Primer: A677_R AGCATGCCTGGAACTACTCTG
Reviews

Customers who bought this product also purchased
A674
A674
A673
A673
A671
A671
A679
A679
Wish a SNP
Wish a SNP
A676
A676
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14
$18.00
Haplogroup Info
Other products
Currencies