Top » Catalog » R1b » A680

$18.00

A680
[A680]

A680
hg38 Position: ChrY:12017889..12017889
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Downstream of L1 > A412/A415/A531
Forward Primer: A680_F TCTTCTGCTGTAGAATTCCAGCT
Reverse Primer: A680_R GCCTGAAAGTGTGGTGGTG
Reviews

Customers who bought this product also purchased
S11515
S11515
S6961
S6961
Z18
Z18
FGC13326
FGC13326
A226
A226
U106
U106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies