Top » Catalog » R1b » A682

$18.00

A682
[A682]

A682
hg38 Position: ChrY:8644031..8644031
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A682_F TTCTTTCCCTGAATTCCATGTC
Reverse Primer: A682_R GCCATCCTACCTGAAGTCTCTTG
Reviews

Customers who bought this product also purchased
A775
A775
A422
A422
A459
A459
R1b-L1402/3 downstream
R1b-L1402/3 downstream
A421
A421
A426
A426
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies