Top » Catalog » R1b » A682

$18.00

A682
[A682]

A682
hg38 Position: ChrY:8644031..8644031
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A682_F TTCTTTCCCTGAATTCCATGTC
Reverse Primer: A682_R GCCATCCTACCTGAAGTCTCTTG
Reviews

Customers who bought this product also purchased
A775
A775
Z16840
Z16840
A418
A418
A423
A423
Z16837
Z16837
A385
A385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies