Top » Catalog » R1b » A682

$18.00

A682
[A682]

A682
hg38 Position: ChrY:8644031..8644031
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A682_F TTCTTTCCCTGAATTCCATGTC
Reverse Primer: A682_R GCCATCCTACCTGAAGTCTCTTG
Reviews

Customers who bought this product also purchased
A775
A775
A426
A426
A420
A420
A425
A425
A419
A419
A424
A424
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies