Top » Catalog » R1b » A683

$18.00

A683
[A683]

A683
hg38 Position: ChrY:12439404..12439404
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106
Forward Primer: A683_F CTCTTTAGGCTATAAAACAATCCCTG
Reverse Primer: A683_R TGCAGGACTAAAGCATGATAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A674
1 x A1080
$36.00
Haplogroup Info
Other products
Currencies