Top » Catalog » R1b » A683

$18.00

A683
[A683]

A683
hg38 Position: ChrY:12439404..12439404
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106
Forward Primer: A683_F CTCTTTAGGCTATAAAACAATCCCTG
Reverse Primer: A683_R TGCAGGACTAAAGCATGATAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A567
1 x A1327
1 x A2163
1 x A127
1 x A1787
1 x A1285
1 x A802
1 x A70
1 x A2145
1 x A990
1 x A97
1 x A552
1 x A425
1 x A787
1 x A68
1 x A2120
$288.00
Haplogroup Info
Other products
Currencies