Top » Catalog » R1b » A684

$19.00

A684
[A684]

A684
hg38 Position: ChrY:17372763..17372763
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Aka ZP33. Below U106
Forward Primer: A684_F TCTATCTGCAGAAGTCTCCCG
Reverse Primer: A684_R TTGTGAAAACCAAGAAGCCC
Reviews

Customers who bought this product also purchased
ZP96
ZP96
FGC15269
FGC15269
FGC15271
FGC15271
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies