Top » Catalog » R1b » A685

$18.00

A685
[A685]

A685
hg38 Position: ChrY:14252405..14252405
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106
Forward Primer: A685_F TTATAATGTTTACATGCTACATCGTCC
Reverse Primer: A685_R CTTTAAGAAGTCATATTATCCCCAGG
Reviews

Customers who bought this product also purchased
DF98
DF98
S1894
S1894
Z381
Z381
S1911
S1911
A7207
A7207
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A743
1 x A235
1 x A777
$54.00
Haplogroup Info
Other products
Currencies