Top » Catalog » R1b » A685

$18.00

A685
[A685]

A685
hg38 Position: ChrY:14252405..14252405
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1 (not listed)
Comments: Below U106
Forward Primer: A685_F TTATAATGTTTACATGCTACATCGTCC
Reverse Primer: A685_R CTTTAAGAAGTCATATTATCCCCAGG
Reviews

Customers who bought this product also purchased
S18823
S18823
A14202
A14202
L48
L48
FGC14840
FGC14840
DF96
DF96
S4004
S4004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A164
1 x A792
$36.00
Haplogroup Info
Other products
Currencies