Top » Catalog » R1b » A687

$18.00

A687
[A687]

A687
hg38 Position: ChrY:8431075..8431075
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a1a2b2a1
Comments: Below U106
Forward Primer: A687_F CTAGATGATGGGTACAGAGATATATTACC
Reverse Primer: A687_R TTCCGAAGACTTTCCCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1491
1 x A274
$36.00
Haplogroup Info
Other products
Currencies