Top » Catalog » R1b » A689

$18.00

A689
[A689]

A689
hg38 Position: ChrY:2926067..2926067
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1b4e1a2a
Comments: Below U106
Forward Primer: A689_F CTCAAACTCCTGGGCTCAAG
Reverse Primer: A689_R GCATCTAACTCAGTGATCAGAAGG
Reviews

Customers who bought this product also purchased
FGC8571
FGC8571
FGC13261
FGC13261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies