Top » Catalog » R1b » A693

$18.00

A693
[A693]

A693
hg38 Position: ChrY:17095100..17095100
Ancestral: G
Derived: A
Reference: Steve Louis (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S9294. aka SL3
Forward Primer: A693_F ATAGTGCCCTGGTGAAAATAGG
Reverse Primer: A693_R CCAAGAATGACTTAGTCCACTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A559
1 x A466
1 x A600
1 x A817
1 x A770
1 x A2118
1 x A1279
1 x A442
1 x A903
1 x A2133
1 x A90
1 x A949
1 x A1318
1 x A1770
1 x A935
1 x A159
1 x A312
$306.00
Haplogroup Info
Other products
Currencies