Top » Catalog » R1b » A625

$18.00

A625
[A625]

A625
hg38 Position: ChrY:12653581..12653581
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2~
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A625_F TGTGAGCCACTGTACCCAGTC
Reverse Primer: A625_R GTGCAAAACTTACACTCTCAAAGTG
Reviews

Customers who bought this product also purchased
S1141
S1141
A627
A627
A635
A635
A640
A640
A613
A613
A633
A633
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies