Top » Catalog » R1b » A627

$18.00

A627
[A627]

A627
hg38 Position: ChrY:13713256..13713256
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A627_F TGCTGAAACATGGACAAACC
Reverse Primer: A627_R AGAGGCAGAAGGAGCTGTACC
Reviews

Customers who bought this product also purchased
A625
A625
A613
A613
A125
A125
S1141
S1141
A636
A636
A638
A638
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A631
$18.00
Haplogroup Info
Other products
Currencies