Top » Catalog » R1b » A631

$18.00

A631
[A631]

A631
hg38 Position: ChrY:16065507..16065507
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A631_F CTGACCATGTCCCATGACATAG
Reverse Primer: A631_R TTCCTCCTGTATGCCAGAGC
Reviews

Customers who bought this product also purchased
A622
A622
A628
A628
A624
A624
A623
A623
A125
A125
S1141
S1141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1734
1 x A557
1 x A776
$54.00
Haplogroup Info
Other products
Currencies