Top » Catalog » R1b » A636

$18.00

A636
[A636]

A636
hg38 Position: ChrY:19017216..19017216
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A636_F GCCACACAATAATCCTCATGC
Reverse Primer: A636_R AAGTGATGGCAGCTCATGC
Reviews

Customers who bought this product also purchased
M9
M9
L151
L151
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
U106
U106
Y23485
Y23485
L51
L51
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A225
1 x A902
1 x A1259
1 x A1537
1 x A419
1 x A2219
1 x A603
1 x A777
1 x A206
1 x A625
1 x A2253
1 x A1160
1 x A317
$234.00
Haplogroup Info
Other products
Currencies