Top » Catalog » R1b » A694

$18.00

A694
[A694]

A694
hg38 Position: ChrY:14751304..14751304
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Approx. S7814
Forward Primer: A694_F ACTTTCCGATGTGTTCTTTTCAG
Reverse Primer: A694_R TCCCAGGGAAAACACAATAAAC
Reviews

Customers who bought this product also purchased
A13155
A13155
FGC29785
FGC29785
PF2028
PF2028
BY205
BY205
DF13
DF13
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
1 x A2132
1 x A1171
1 x A171
1 x A1292
1 x A1339
1 x A2121
1 x A2123
1 x A2151
1 x A2197
1 x A1782
1 x A637
1 x A859
$270.00
Haplogroup Info
Other products
Currencies