Top » Catalog » R1b » A700

$18.00

A700
[A700]

A700
hg38 Position: ChrY:11871709..11871709
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Between FGC5496/FGC7448 and CTS2457
Forward Primer: A700_F AAAAGGAAAGCCTGGGAAAG
Reverse Primer: A700_R GAGCTAAACACTGGGTAGCTCC
Reviews

Customers who bought this product also purchased
A193
A193
A192
A192
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A247
1 x A315
1 x A1504
1 x A353
1 x A593
1 x A172
1 x A730
$126.00
Haplogroup Info
Other products
Currencies