Top » Catalog » R1b » A6

$18.00

A6
[A6]

A6
hg38 Position: ChrY:14498465..14498465
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a
Comments: Found in a R1b-L513 person
Forward Primer: A6_F GAGAGAGGTGCCAGAAATGG
Reverse Primer: A6_R ATTTCAGGGTGTTGGACAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A97
1 x A48
1 x A120
1 x A14
1 x A47
1 x A119
1 x A95
$126.00
Haplogroup Info
Other products
Currencies