Top » Catalog » R1b » A712

$18.00

A712
[A712]

A712
hg38 Position: ChrY:8814127..8814127
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1402
Forward Primer: A712_F CCCCAATGTATGTTTCTGTTAGATAG
Reverse Primer: A712_R ACCACTCTAATATCTCCTTGCCTAAC
Reviews

Customers who bought this product also purchased
A1369
A1369
A1344
A1344
R1b-L1402/3 downstream
R1b-L1402/3 downstream
A421
A421
A426
A426
A420
A420
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1504
$18.00
Haplogroup Info
Other products
Currencies