Top » Catalog » R1b » A712

$18.00

A712
[A712]

A712
hg38 Position: ChrY:8814127..8814127
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1402
Forward Primer: A712_F CCCCAATGTATGTTTCTGTTAGATAG
Reverse Primer: A712_R ACCACTCTAATATCTCCTTGCCTAAC
Reviews

Customers who bought this product also purchased
A1369
A1369
A1344
A1344
A424
A424
Z16840
Z16840
A418
A418
A423
A423
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A599
1 x A212
1 x A586
1 x A232
1 x A295
1 x A193
1 x A308
1 x A1280
1 x A2196
1 x A22
1 x A156
$198.00
Haplogroup Info
Other products
Currencies