Top » Catalog » R1b » A713

$18.00

A713
[A713]

A713
hg38 Position: ChrY:15274229..15274229
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1402
Forward Primer: A713_F AGGAGTCACAAATGCATTCAAG
Reverse Primer: A713_R CCTCACCCTATCCTTCCCTATG
Reviews

Customers who bought this product also purchased
A1344
A1344
A682
A682
A712
A712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A139
$18.00
Haplogroup Info
Other products
Currencies