Top » Catalog » R1b » A714

$18.00

A714
[A714]

A714
hg38 Position: ChrY:11055315..11055315
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4b
Comments: Found in CTS4466 individuals. Downstream of A151
Forward Primer: A714_F CCTGGGTTACAACTTCAATCG
Reverse Primer: A714_R AGCTTTGTTTAGACACTCCCTTGT
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
A661
A661
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies