Top » Catalog » R1b » A715

$18.00

A715
[A715]

A715
hg38 Position: ChrY:13461271..13461271
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4b
Comments: Found in CTS4466 individuals. Downstream of A151
Forward Primer: A715_F TGAAAACAGAAGCAATTGTCAAAG
Reverse Primer: A715_R CATCATGGAAGCGAGGAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
$180.00
Haplogroup Info
Other products
Currencies