Top » Catalog » R1b » A716

$18.00

A716
[A716]

A716
hg38 Position: ChrY:15781798..15781798
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4b
Comments: Found in CTS4466 individuals. Downstream of A151
Forward Primer: A716_F TCAGATGGATTAACTGAGTCACCTAC
Reverse Primer: A716_R GCTTTTACAAACATCACTCCACAC
Reviews

Customers who bought this product also purchased
A9865
A9865
A12018
A12018
FGC27968
FGC27968
A12087
A12087
FGC11134
FGC11134
S1115
S1115
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies