Top » Catalog » R1b » A717

$18.00

A717
[A717]

A717
hg38 Position: ChrY:19656068..19656068
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4b
Comments: Found in CTS4466 individuals. Downstream of A151
Forward Primer: A717_F CAGTGAATTGTGTTTTGTATATCTTGG
Reverse Primer: A717_R CAAAACCTGGAAGAGTAGGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A640
1 x A1230
1 x A2159
1 x A1499
1 x A238
1 x A1753
1 x A1490
1 x A534
1 x A1064
1 x A494
1 x A588
1 x A772
1 x A739
1 x A1746
$252.00
Haplogroup Info
Other products
Currencies