Top » Catalog » R1b » A431

$18.00

A431
[A431]

A431
hg38 Position: ChrY:8595740..8595740
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2a4
Comments: Approx. DF27
Forward Primer: A431_F AACCCCTCCACTTCCAATG
Reverse Primer: A431_R CCACGGATCCCAAAGAGAAC
Reviews

Customers who bought this product also purchased
FGC40704
FGC40704
Y16018
Y16018
BY15279
BY15279
CTS416
CTS416
Y12470
Y12470
Z2543
Z2543
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A994
$18.00
Haplogroup Info
Other products
Currencies