Top » Catalog » R1b » A719

$18.00

A719
[A719]

A719
hg38 Position: ChrY:2858839..2858839
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A719_F GATCATTTGGCCATATATGCTTG
Reverse Primer: A719_R CAGAAGAAAGACCTCAAATGAATAGC
Reviews

Customers who bought this product also purchased
A720
A720
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A592
1 x A1174
1 x A33
1 x A2132
1 x A1171
1 x A171
1 x A1292
1 x A1339
1 x A2121
1 x A2123
1 x A2151
1 x A2197
1 x A1782
1 x A637
1 x A859
$270.00
Haplogroup Info
Other products
Currencies