Top » Catalog » R1b » A720

$18.00

A720
[A720]

A720
hg38 Position: ChrY:2859524..2859524
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A720_F ACCTGCCTTTTTGTGCTCTG
Reverse Primer: A720_R TCAGGATGAAACAAAAGGATGTC
Reviews

Customers who bought this product also purchased
A719
A719
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A81
1 x A1117
1 x A996
1 x A679
1 x A1746
$90.00
Haplogroup Info
Other products
Currencies