Top » Catalog » R1b » A722

$18.00

A722
[A722]

A722
hg38 Position: ChrY:12813553..12813553
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A722_F CAAAACTTCAGAGTAACAGGAAGG
Reverse Primer: A722_R GTGATTGAAAACGTCCTCACC
Reviews

Customers who bought this product also purchased
A723
A723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies