Top » Catalog » R1b » A722

$18.00

A722
[A722]

A722
hg38 Position: ChrY:12813553..12813553
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A722_F CAAAACTTCAGAGTAACAGGAAGG
Reverse Primer: A722_R GTGATTGAAAACGTCCTCACC
Reviews

Customers who bought this product also purchased
A723
A723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
1 x A240
1 x A896
1 x A848
1 x A344
1 x A16
1 x A1067
1 x A1120
1 x A938
1 x A1341
1 x A568
1 x A2200
1 x A583
1 x A1226
1 x A653
$324.00
Haplogroup Info
Other products
Currencies