Top » Catalog » R1b » A726

$18.00

A726
[A726]

A726
hg38 Position: ChrY:8661335..8661335
Ancestral: C
Derived: T
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b1a2
Comments: Under CTS4466 S1121 Z16251 S1126. Found in two Irish Type II participants
Forward Primer: A726_F TCATCCTGGGTTTTCCTGAG
Reverse Primer: A726_R ATCTGTGGCAAAAGGCAGTC
Reviews

Customers who bought this product also purchased
A808
A808
A804
A804
A923
A923
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A542
A542
A664
A664
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A763
1 x A1094
1 x A2261
1 x A752
1 x A151
1 x A2262
1 x A541
1 x A386
$162.00
Haplogroup Info
Other products
Currencies