Top » Catalog » R1b » A726

$18.00

A726
[A726]

A726
hg38 Position: ChrY:8661335..8661335
Ancestral: C
Derived: T
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b1a2
Comments: Under CTS4466 S1121 Z16251 S1126. Found in two Irish Type II participants
Forward Primer: A726_F TCATCCTGGGTTTTCCTGAG
Reverse Primer: A726_R ATCTGTGGCAAAAGGCAGTC
Reviews

Customers who bought this product also purchased
A804
A804
A808
A808
A1133
A1133
A159
A159
A806
A806
Z16521
Z16521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies