Top » Catalog » R1b » A729

$18.00

A729
[A729]

A729
hg38 Position: ChrY:19152463..19152463
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L21 > S691
Forward Primer: A729_F TCTCTTGCCTTTTGTCTATAGAAGC
Reverse Primer: A729_R CAAAGTAACTGAGGTCTTGGCTG
Reviews

Customers who bought this product also purchased
A739
A739
FGC19639
FGC19639
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A861
1 x A928
1 x A154
1 x A256
1 x A1759
$90.00
Haplogroup Info
Other products
Currencies