Top » Catalog » R1b » A729

$18.00

A729
[A729]

A729
hg38 Position: ChrY:19152463..19152463
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L21 > S691
Forward Primer: A729_F TCTCTTGCCTTTTGTCTATAGAAGC
Reverse Primer: A729_R CAAAGTAACTGAGGTCTTGGCTG
Reviews

Customers who bought this product also purchased
FGC19639
FGC19639
A739
A739
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
1 x A554
1 x A970
1 x A680
1 x A191
1 x A185
1 x A463
1 x A415
1 x A1201
1 x A445
1 x A1117
$378.00
Haplogroup Info
Other products
Currencies