Top » Catalog » R1b » A730

$18.00

A730
[A730]

A730
hg38 Position: ChrY:8073406..8073406
Ancestral: G
Derived: C
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A730_F AGGACACAGGCTGCAGAG
Reverse Primer: A730_R GCCTCAGCCTCCTAAATTCC
Reviews

Customers who bought this product also purchased
FGC15273
FGC15273
FGC15268
FGC15268
A731
A731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1737
1 x A725
1 x A1262
1 x A423
1 x A240
1 x A104
1 x A2200
1 x A1185
1 x A1341
$162.00
Haplogroup Info
Other products
Currencies