Top » Catalog » R1b » A731

$18.00

A731
[A731]

A731
hg38 Position: ChrY:20440964..20440964
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A731_F GTGCAAGAAAAGGGAAATGC
Reverse Primer: A731_R TCTCAAGGTGTGGCTTCCTC
Reviews

Customers who bought this product also purchased
A730
A730
FGC15273
FGC15273
FGC15268
FGC15268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2250
1 x A244
1 x A1719
1 x A2185
1 x A240
1 x A896
1 x A848
1 x A344
1 x A16
$162.00
Haplogroup Info
Other products
Currencies