Top » Catalog » R1b » A733

$18.00

A733
[A733]

A733
hg38 Position: ChrY:7672935..7672935
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A733_F GAATGTTCATCCCGACTAGAGC
Reverse Primer: A733_R AAAGGAGCTCCCACAGTGC
Reviews

Customers who bought this product also purchased
A737
A737
A736
A736
A735
A735
A734
A734
A732
A732
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A197
1 x A2116
1 x A363
1 x A2216
1 x A54
1 x A101
1 x A2150
1 x A1030
1 x A1071
1 x A1319
1 x A2186
1 x A882
1 x A103
1 x A627
1 x A2187
1 x A874
1 x A823
1 x A2224
1 x A892
1 x A286
1 x A693
$378.00
Haplogroup Info
Other products
Currencies