Top » Catalog » R1b » A734

$18.00

A734
[A734]

A734
hg38 Position: ChrY:12689640..12689640
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A734_F CAAGAGGTTTAGAGGCCAGAG
Reverse Primer: A734_R GGGGAGAAGGTGCCTTAGAG
Reviews

Customers who bought this product also purchased
A735
A735
A733
A733
A732
A732
A737
A737
A736
A736
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A342
1 x A1080
1 x A694
1 x A2170
1 x A7
1 x A1766
1 x A1141
1 x A570
1 x A2071
1 x A683
1 x A2146
1 x A554
1 x A970
1 x A680
1 x A191
1 x A185
1 x A463
1 x A415
1 x A1201
1 x A445
1 x A1117
$378.00
Haplogroup Info
Other products
Currencies