Top » Catalog » R1b » A735

$19.00

A735
[A735]

A735
hg38 Position: ChrY:13842702..13842702
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A735_F TCCCTCTTGAAGCTTCCTTG
Reverse Primer: A735_R CCTATGGGTAGACGGTTCAGG
Reviews

Customers who bought this product also purchased
A737
A737
A736
A736
A733
A733
A734
A734
A732
A732
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies