Top » Catalog » R1b » A736

$18.00

A736
[A736]

A736
hg38 Position: ChrY:14859174..14859174
Ancestral: A
Derived: C
Reference: Bruce Cockburn (2014)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: R1b/U106/L257
Forward Primer: A736_F TTGTCACAAACCAGACATACAGG
Reverse Primer: A736_R CTGCCTACTCAAGCCTCACC
Reviews

Customers who bought this product also purchased
A733
A733
A734
A734
A732
A732
A737
A737
A735
A735
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies