Top » Catalog » R1b » A738

$18.00

A738
[A738]

A738
hg38 Position: ChrY:15191400..15191400
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1~
Comments: Below M222 > S660
Forward Primer: A738_F AAATCACTAACATATCAAGAACCTTCAG
Reverse Primer: A738_R GAATATGTTTGCAAATATGACTAATTGC
Reviews

Customers who bought this product also purchased
A984
A984
A10528
A10528
BY18130
BY18130
A1775
A1775
FGC33468
FGC33468
ZS8379
ZS8379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies